View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17171_high_4 (Length: 252)

Name: NF17171_high_4
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17171_high_4
NF17171_high_4
[»] chr6 (1 HSPs)
chr6 (13-166)||(33890137-33890290)


Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 166
Target Start/End: Complemental strand, 33890290 - 33890137
Alignment:
13 aatatattagtgacattattggtaataaaaaattattaaaatcattaatagttatgatgttgaaaagttggctcaccatgagtctttaaaaacctctgaa 112  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||    
33890290 aatatattagtgacattattggtaataaaaagttattaaaatcattaatagttatgatgttgaaaatttggctcaccatgagtctttaaaaacctctaaa 33890191  T
113 gaacataacttgttgcagcaaattctttctcaaatctctagaaataatgtctca 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33890190 gaacataacttgttgcagcaaattctttctcaaatctctagaaataatgtctca 33890137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University