View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17171_low_4 (Length: 252)
Name: NF17171_low_4
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17171_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 166
Target Start/End: Complemental strand, 33890290 - 33890137
Alignment:
| Q |
13 |
aatatattagtgacattattggtaataaaaaattattaaaatcattaatagttatgatgttgaaaagttggctcaccatgagtctttaaaaacctctgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
33890290 |
aatatattagtgacattattggtaataaaaagttattaaaatcattaatagttatgatgttgaaaatttggctcaccatgagtctttaaaaacctctaaa |
33890191 |
T |
 |
| Q |
113 |
gaacataacttgttgcagcaaattctttctcaaatctctagaaataatgtctca |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33890190 |
gaacataacttgttgcagcaaattctttctcaaatctctagaaataatgtctca |
33890137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University