View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17171_low_5 (Length: 239)
Name: NF17171_low_5
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17171_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 4809211 - 4809413
Alignment:
| Q |
17 |
aggaatgagaatcagagatgcaaggaacaacactagaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4809211 |
aggaatgagaatcagagatgcaaggaacaacactagaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatag |
4809310 |
T |
|
| Q |
117 |
ggagtactactcatgttttatactggattgttaggaggatcaatgagtgggtggggggttgtgcaattattgattagattacgtcagggctgatgtcaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4809311 |
ggagtactactcatgttttatactggattgttagggggatcaatgagtgaagggggg---gtgcaattattgattagattacgtcagggctgatgtcata |
4809407 |
T |
|
| Q |
217 |
tgccta |
222 |
Q |
| |
|
|||||| |
|
|
| T |
4809408 |
tgccta |
4809413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 4668315 - 4668347
Alignment:
| Q |
17 |
aggaatgagaatcagagatgcaaggaacaacac |
49 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
4668315 |
aggaatgagaatcagagatgcaaggaaaaacac |
4668347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University