View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17171_low_7 (Length: 234)
Name: NF17171_low_7
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17171_low_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 234
Target Start/End: Complemental strand, 33890492 - 33890270
Alignment:
| Q |
10 |
ataatactataaccatgtcatctatctatttagggaattagcataatgtgatgaaactcctacaattttcttgcctttttaaaacaaaaagagcaaatgc |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33890492 |
ataatactataaccatgtcatttatctatttagggaattagcataatgtgatgaaactcctacaattttcttgcctttttaaaacaaaaagagcaaatgc |
33890393 |
T |
 |
| Q |
110 |
tataattgtatgtaaggaatgctttgcacaactctgtgtgatttaaaagatgtaaatttatgctacaaatattaaagagtaataatattaatatttggtc |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33890392 |
tataattgtatgtagggaatgctttgcataactc--tgtgatttaaaagatgtgaatttatgctacaaatattaaagagtaataatattaatatttggtc |
33890295 |
T |
 |
| Q |
210 |
aaaaaatatattagtgacattattg |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33890294 |
aaaaaatatattagtgacattattg |
33890270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University