View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17172_low_3 (Length: 412)
Name: NF17172_low_3
Description: NF17172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17172_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 29 - 395
Target Start/End: Complemental strand, 42141420 - 42141055
Alignment:
| Q |
29 |
gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggnnnnnnngacagcaccgtataagctagaagggaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42141420 |
gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggtttttttgacagcaccgtataagctagaagggaa |
42141321 |
T |
 |
| Q |
129 |
aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42141320 |
aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata |
42141221 |
T |
 |
| Q |
229 |
aacccgttcggtctatttttatcctcaaaatttgtagccatactggtatcaattacattctcgtgtctatgtatgtaagtttttagagtgttgcctaact |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||| || |
|
|
| T |
42141220 |
aacccgttcggtcta-ttttatcctcaaaatttgtagccatactggtatcaattacattctcgtgtctatgtatgtaaatttttagattggtgcctatct |
42141122 |
T |
 |
| Q |
329 |
gaggtgttttggttagtaaaaaacattgttgtttggctatggagctaacgcgacaggacgaggtggc |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42141121 |
gaggtgttttggttagtaaaaaacattgttgtttggctatggagttaacgcgacaggacgaggtggc |
42141055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University