View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17173_low_10 (Length: 208)
Name: NF17173_low_10
Description: NF17173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17173_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 855840 - 855662
Alignment:
| Q |
18 |
cctagctaggtaaaatgtgagctgaaagacttcttcttttgtcgttgtttaatcttcaacttcacattaatgccactatcaatgatggaattaagaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
855840 |
cctagctaggtaaaatgtgagctgaaagacttcttcttttgtcgttgtttaatcttcaacttcacattaatgccactatcaatgatggaattaagaacaa |
855741 |
T |
 |
| Q |
118 |
tctgaagcttcccctccaccctttctcctttccttggagtataaataatatcatgaatatcatcagccaatgctctctg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
855740 |
tctgaagcttcccctccaccctttctcctttccttggagtataaataatatcatgaatatcatcagccaatgctctctg |
855662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University