View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17176_high_10 (Length: 440)
Name: NF17176_high_10
Description: NF17176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17176_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 54436707 - 54436836
Alignment:
| Q |
1 |
tcgacggcaacgtggatctgttcttcttgggtttgacactgttgaaagaggatttgtgagtgagggacaatttgtcactgtatttttgtttgtggttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54436707 |
tcgacggcaacgtggatctgttcttcttcgatttgacactgttgaaagaggatttgtgagtgagggacaatttgtcactgtatttttgtttgtggttgtt |
54436806 |
T |
|
| Q |
101 |
ccatccaattttttgttgacactctttcaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54436807 |
ccatccaattttttgttgacactctttcaa |
54436836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 276 - 337
Target Start/End: Original strand, 54436982 - 54437043
Alignment:
| Q |
276 |
ctgggatgaaatttgttgagagagatttgtcactgccttttgagttatttgcagggatgaaa |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54436982 |
ctgggatgaaatttgttgagagagatttgtcactgccttttgagttatttgcagggatgaaa |
54437043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University