View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17176_high_26 (Length: 244)
Name: NF17176_high_26
Description: NF17176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17176_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 17811965 - 17812171
Alignment:
| Q |
19 |
agcatggttccgttgagtcgtctgttgcaggttcttctccactggaagggggatggtgtacctgcactgcacgcgctccgacactctctttcttgaaccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
17811965 |
agcatggttccgttgagtcgtctgttgcaggttcttctccaccggaaggggggtggtgtacctgcactgcatgtgctctgaca--ctctttcttgaaccc |
17812062 |
T |
|
| Q |
119 |
ctcacttctccagccatctatgcctggggtacggacatgagtaa-ccctcggggtggtaaggagctctcggattaatggtgaggaaatctcggcctgtac |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17812063 |
ctcacttctccagccatctattcctggggtacggacatgagtaacccctcggggtggtgaggagctctcggattaatggtgaggaaatctcggcctgtac |
17812162 |
T |
|
| Q |
218 |
cgtaatcca |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
17812163 |
cgtaatcca |
17812171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University