View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17176_low_25 (Length: 250)
Name: NF17176_low_25
Description: NF17176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17176_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 2795183 - 2794952
Alignment:
| Q |
11 |
cacagataagttgcacctgttttctgctggttgcgttttacaagatcatcaaatcacgttgggaccaaagtaaatgac-ttttctgtcttgagcgtctct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
2795183 |
cacagataagttgcacctgttttctgctggttgcattttacaagatcatcaaatcacgttgggaccaaagtaaatgactttttctgtcttgagtgtctct |
2795084 |
T |
 |
| Q |
110 |
tcgtcatacatacccaaccagaatcacaaaatgttgtaagcttaggattttatgcattgattagataaattccatgtgaaatgtttgatttgagacatta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2795083 |
tcgtcatacatacccaaccagaatcacaaaatgttgtaagc---------tatgcattgattagataaattccatgtgaaatggttgatttgagacatta |
2794993 |
T |
 |
| Q |
210 |
tagaataggcttcaatgcataaatgtttttctgaagtttgt |
250 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
2794992 |
tagaataggcttcaatgcatgaatgtctttctgaagtttgt |
2794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University