View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17176_low_31 (Length: 224)
Name: NF17176_low_31
Description: NF17176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17176_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 24914074 - 24914267
Alignment:
| Q |
17 |
agattgaaaaccagtaatagaacattgattatgacataacaaaggagattatttttatgtacaataggtttaacaaaatcagttcagatcaaaaacagca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
24914074 |
agattgaaaaccagtaatagaacattgattatgacataacaaaggagattattttcatgtacaataggtttaactaaatcagttcagatc-aaaacagca |
24914172 |
T |
 |
| Q |
117 |
agatttacctttgttgaattaaaagtctcaatagaagcaagatttccatcgatgaaactcaagagatgtttgttatgctccaatagggcctttgc |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
24914173 |
agatttaccttcgttgaattaaaagtctcaatagaagcaagatttccatcgattaaacttaagagctgtttgttgtgctccaatagtgcctttgc |
24914267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University