View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17177_low_7 (Length: 236)
Name: NF17177_low_7
Description: NF17177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17177_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 12308339 - 12308561
Alignment:
| Q |
1 |
taaaccaaaaaatgacaaaatattgga-gggtaaggaaaatagttgtaaggaggaaaacatgaacaatgagcttctnnnnnnnctgttccaaacttccaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12308339 |
taaaccaaaaaatgacaaaatattggaagggtaaggaaaatagttgtaaggaggaaaacatgaacaatgagcttctaaaaaaactgttccaaacttccaa |
12308438 |
T |
|
| Q |
100 |
tgaaattttctgatacttaggtggagcttctgaaaaagaccaccgtttgaacccaagttttaccaatag-gttttttatacatgtttgtctcacttaaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12308439 |
tgaaattttctgatacttaggtggagcttctgaaaaagaccaccgtttgaaccctagttttaccaatagatttttttatacatgtttgtctcacttaaag |
12308538 |
T |
|
| Q |
199 |
gagagtggatactttgtacttat |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12308539 |
gagagtggatactttgtacttat |
12308561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University