View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_high_32 (Length: 236)
Name: NF17179_high_32
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 41 - 217
Target Start/End: Complemental strand, 35034178 - 35034002
Alignment:
| Q |
41 |
tacacatacttgcattgacacatataaaataggtaaatagttacctaggattgttaggatttcctttgatctctttgcatccgtacttgcgccaacaata |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034178 |
tacacatacttgcattgacacatataaaataggtaaatagttacctaggattgttaggatttcctttgatctctttgcatccgtacttgcgccaacaata |
35034079 |
T |
|
| Q |
141 |
accatcatccaaaatgtcttcatcgctttcaactcggatcactattttttgcccgacatctgtcatggggcaaggtg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35034078 |
accatcatccaaaatgtcttcatcgctttcaactcggatcactattttttgcccggcatctgtcatggggcaaggtg |
35034002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 189
Target Start/End: Complemental strand, 32571517 - 32571357
Alignment:
| Q |
29 |
catttatcaatatacacatacttgcattgacacatataaaataggtaaatagttacctaggattgttaggatttcctttgatctctttgcatccgtactt |
128 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||| ||| ||||||||| ||||||||| | |||| ||||||||||||||| |||| ||| ||||| |
|
|
| T |
32571517 |
catttataaatatacatatacttgcattggcaccagggaaaaaggtaaataattacctagggtaattagcatttcctttgatctccttgcgtccatactt |
32571418 |
T |
|
| Q |
129 |
gcgccaacaataaccatcatccaaaatgtcttcatcgctttcaactcggatcactattttt |
189 |
Q |
| |
|
|||| | ||||||||||| || ||||||||| | |||||| || || ||||| |||| |
|
|
| T |
32571417 |
atgccagcgataaccatcattcactttgtcttcattgatttcaattctgaacactactttt |
32571357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University