View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_low_17 (Length: 365)
Name: NF17179_low_17
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_low_17 |
 |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0115 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 34647 - 34375
Alignment:
| Q |
14 |
caaaggtagaattactattgcttatggttaaagtgacagtgattgggctggagatggacatgatcctaagagtacgattagtgctcttcatggaaaacac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647 |
caaaggtagaattactattgcttatggttaaagtgacagtgattgggctggagatggacatgatcctaagagtacgattagtgctcttcatggaaaacac |
34548 |
T |
 |
| Q |
114 |
atctttcacttgaatgtcgaagaagtaaaaaattgtcgtgctttcaattgtaaggcaaagtatgtagcaactacatcatgtgtttgtcgcacgatttggc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
34547 |
atctttcacttgaatgtcgaagaagtaaaaaattgtcgtgctttcaattgtaaggcaaagtatgtagcaactacatcatgtgttagtcgcaccatttggc |
34448 |
T |
 |
| Q |
214 |
ttaaaagtttgttaaatgagagtagccaaaaaagattttcatggataacaagtcattcattgttcttgcaaag |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34447 |
ttaaaagtttgttaaatgagagtagccaaaaaagattttcatggataacaagtcattcattgttcttgcaaag |
34375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University