View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_low_24 (Length: 318)
Name: NF17179_low_24
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 23923037 - 23922789
Alignment:
| Q |
1 |
ggtggtagaagatgtagatgcagcaagaacagccctaaaatgggctctaataaacatcattagatatggtgatataatcacacttcttcatgtttacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23923037 |
ggtggtagaagatgtagatgcagcaagaacagccctaaaatgggctctaataaacatcattagatatggtgatataatcacacttcttcatgtttacaat |
23922938 |
T |
|
| Q |
101 |
tcttctaacacaagatcaagaagtagaagtagaagcagaagcaaagctcgtcttcttcgcctcgacggttttcgattagcactatcatttcaagacattt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23922937 |
tcttctaacacaagatcaagaagaagaagtagaagtagaagcaaagctcgtcttcttcgcctcgacggttttcgattagcactttcatttcaagacattt |
23922838 |
T |
|
| Q |
201 |
gcaacgattatcccaatgtatgtataatatgtttgattgttagttcata |
249 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
23922837 |
gcaacgattatcccaatgtatgtatactatgtttgattcttagttcata |
23922789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University