View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_low_28 (Length: 254)
Name: NF17179_low_28
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 20557186 - 20557409
Alignment:
| Q |
16 |
gaagttattggagaaagaaaaaggc-gaatatgacatgtctatatgagttatcccaatagtaaatccatcatattttactgcgttagcttttgttttact |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20557186 |
gaagttattggagaaagaaaaaggaagaatgtgacatgtctatatgagttatcccaatagtaaatccatcatattttacttcgttagcttttgttttact |
20557285 |
T |
 |
| Q |
115 |
caaccttagcatgttcggatatnnnnnnnntttaaaatttatatttgatcaatgcatggtaggattggtgaaatatgttttagcttagagtgaaaaaatt |
214 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20557286 |
caaccttagcatgttcgaatat-aaaaaaatttaaaatttatatttgatcaatgcatggtaggattggtgaaatatgttttagcttagagtgaaaaaatt |
20557384 |
T |
 |
| Q |
215 |
cattactttatacaatcattaatct |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20557385 |
cattactttatacaatcattaatct |
20557409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University