View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_low_32 (Length: 239)
Name: NF17179_low_32
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 29008849 - 29008631
Alignment:
| Q |
18 |
aaccacaccgttggtggtgcttccgcctgggatcttgaatccaatatgcaggtttgggcttccactgagagcttcaacgtcggcgacgatctcggtacgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008849 |
aaccacaccgttggtggtgcttccgcctgggatcttgaatccaatatgcaggattgggcttccactgagagcttcaacgtcggcgacgatctcggtacgt |
29008750 |
T |
 |
| Q |
118 |
ttcttcatgtcttgaattgatttcaacagaatcattttcgtgaaaatgcaaaaaacggttacgatcttatattattaatctttgaattttctgaaacttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008749 |
ttcttcatgtcttgaattgatttcaacagaatcattttcgtgaaaatacaaaaaacggttacgatcttatattattaatctttgaattttctgaaacttt |
29008650 |
T |
 |
| Q |
218 |
ctatatattttggtaaaga |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29008649 |
gtatatattttggtaaaga |
29008631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 83 - 239
Target Start/End: Original strand, 21408425 - 21408578
Alignment:
| Q |
83 |
tgagagcttcaacgtcggcgacgatctcggtacgtttcttcatgtcttgaattgatttcaacagaatcattttcgtgaaaatgcaaaaaa--cggttacg |
180 |
Q |
| |
|
|||||||||||| ||||| ||| || | |||||||||||||||||||||| |||||| ||||||||||| ||||||| ||||||| | |||||| |
|
|
| T |
21408425 |
tgagagcttcaatgtcggtgacaattttggtacgtttcttcatgtcttga-----tttcaatagaatcatttttgtgaaaacacaaaaaaaacagttacg |
21408519 |
T |
 |
| Q |
181 |
atcttatattattaatctttgaattttctgaaactttctatatattttggtaaagattt |
239 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
21408520 |
atcttgtataattaatctttgaattttctgaaactttgtatattttttggtaaagattt |
21408578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University