View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17179_low_39 (Length: 210)
Name: NF17179_low_39
Description: NF17179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17179_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 58 - 192
Target Start/End: Complemental strand, 41460806 - 41460675
Alignment:
| Q |
58 |
aattgaagaagtcatattcaggattaagcaactaaacaaacaatgaaattgaattataagaagaaattcagaagaatgatagcataccaataggaggaat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41460806 |
aattgaagaagtcatattcaggattaagcaactaaacaaacaatgaaattgaattataagaa---attcagaagaatgatagcataccaataggaggaat |
41460710 |
T |
|
| Q |
158 |
acgattgaaaaaagagaaatcagtgcggcgtttag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41460709 |
acgattgaaaaaagagaaatcagtgcggcgtttag |
41460675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 62
Target Start/End: Complemental strand, 41460886 - 41460845
Alignment:
| Q |
20 |
atgctaaggaaggagaaaaggggatctactacaattggaattg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41460886 |
atgctaaggaaggagaaaaggggatcta-aacaattggaattg |
41460845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University