View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717R-Insertion-1 (Length: 112)
Name: NF1717R-Insertion-1
Description: NF1717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717R-Insertion-1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 36026472 - 36026568
Alignment:
| Q |
16 |
atatgatgatgccattttccaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtatttgtaagttttt |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026472 |
atatgatgatgccatttttcaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtatttgtaagttttt |
36026568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 102
Target Start/End: Complemental strand, 16933901 - 16933824
Alignment:
| Q |
25 |
tgccattttccaaccccagttggataagtatgaaacttgtctggatacatagcctgtttaatttctgtttttgtattt |
102 |
Q |
| |
|
||||||||| || || |||||||||| ||| ||| |||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
16933901 |
tgccatttttcagccatagttggataactattaaatttgtctggattcatagcctgttttattttcttttttgtattt |
16933824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University