View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717R-Insertion-4 (Length: 297)
Name: NF1717R-Insertion-4
Description: NF1717R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717R-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 9 - 297
Target Start/End: Original strand, 32875223 - 32875511
Alignment:
| Q |
9 |
agaggagttgcattggaaggtgagaaaggaagaacggtcggccttactccacctgctgtcgaggcaatatcagagagttttggggagtgggttatcaatg |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875223 |
agaggagttgcattggaaggcgagaaaggaagaacggtcgaccttactccacctgctgttgaggcaatatcagagagttttggggagtgggttatcaatg |
32875322 |
T |
 |
| Q |
109 |
gtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgggaccctcgagttacagggtcgaaattgagcgttgcagtgtttgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875323 |
gtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgtgaccctcgagttacagggtcgaaattgagcgttgcagtgtttgc |
32875422 |
T |
 |
| Q |
209 |
cggtctttctcgtgctggctgtatggtgttcgatatgggactagctaccacgcctgcttgtttcatgagcacattgttgcctccatttg |
297 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32875423 |
cggtcttgctcgtgctggttgtatggtgttcgatatgggactagctaccacgcccgcttgtttcatgagcacattgttgcctccatttg |
32875511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University