View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_high_11 (Length: 321)
Name: NF1717_high_11
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 4 - 305
Target Start/End: Complemental strand, 32875524 - 32875223
Alignment:
| Q |
4 |
gaagcagcacagacaaatggaggcaacaatgtgctcatgaaacaagcaggcgtggtagctagtcccatatcgaacaccatacagccagcacgagaaagac |
103 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
32875524 |
gaagcatcatagacaaatggaggcaacaatgtgctcatgaaacaagcgggcgtggtagctagtcccatatcgaacaccatacaaccagcacgagcaagac |
32875425 |
T |
|
| Q |
104 |
cggcaaacactgcaacgctcaatttcgaccctgtaactcgagggtcccgtccaagagacacactcacattctcaacaggatatcctttttccttctctaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875424 |
cggcaaacactgcaacgctcaatttcgaccctgtaactcgagggtcacgtccaagagacacactcacattctcaacaggatatcctttttccttctctaa |
32875325 |
T |
|
| Q |
204 |
accattgataacccactccccaaaactctctgatattgcctcgacagcaggtggagtaaggtcgaccgttcttcctttctcaccttccaatgcaactcct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32875324 |
accattgataacccactccccaaaactctctgatattgcctcaacagcaggtggagtaaggtcgaccgttcttcctttctcgccttccaatgcaactcct |
32875225 |
T |
|
| Q |
304 |
ct |
305 |
Q |
| |
|
|| |
|
|
| T |
32875224 |
ct |
32875223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University