View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_high_16 (Length: 264)
Name: NF1717_high_16
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 253
Target Start/End: Complemental strand, 22837048 - 22836802
Alignment:
| Q |
7 |
ttaacaaggttaaactttccggaaactcaccggagaaattattgtaagaaaggaacagaagtcttagtgaagttaagttggagagatttggaatgggacc |
106 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837048 |
ttaacgaggttaaactttcgggaaactcaccggagaaattgttgtaagaaaggaacaaaagtcttagtgaagttaagttggagagatttggaatgggacc |
22836949 |
T |
|
| Q |
107 |
gttgaaacggttgcgtttaaggctgagtacacggagctgagtaagtgcggttaacggttccatcgagccgtggaggtcgaggttttcgaggactaggcgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22836948 |
gttgaaacggttgcgtttaaggctgagtacacggagctgagtaagtgcggttaacggttccatcgagccgtggaggtcgaggttttcgaggacaaggcgg |
22836849 |
T |
|
| Q |
207 |
gagacacggttcctaagacaagagacaccgtaccatgtgcacaggtt |
253 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
22836848 |
gagacacggtttcttagacaagagacaccgtaccatgtgcataggtt |
22836802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University