View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_high_23 (Length: 243)
Name: NF1717_high_23
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_high_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 38731064 - 38730835
Alignment:
| Q |
14 |
atataaattacataaccatgtcgtgtatggatttgctagagagattctctgtttctacttgctaaaacagtaccctacattatgatgcgcattttaacag |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38731064 |
atataaattacacaaccatgtcgtgtatggatttgctagagagattttctgtttctacttgctacaacagtaccctacattatcatgcgcattttaacag |
38730965 |
T |
|
| Q |
114 |
agttacattgttattgtttgatgagttacaatattatcatgtcgtatatatgctcgggctcatgcactcttgtggttagaaaatgagtatatgcactttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38730964 |
agttacattgttattgtttgatgagttacaatattatcatgtcgtatatatactcgggctcatgcactcttgtggttagaaaatgagtatatgcaatttg |
38730865 |
T |
|
| Q |
214 |
gccaaagctggtcaactacttttgttaaaa |
243 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |
|
|
| T |
38730864 |
gccaaagctggtcgactacttttgataaaa |
38730835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University