View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_10 (Length: 331)
Name: NF1717_low_10
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 191 - 329
Target Start/End: Original strand, 10823640 - 10823778
Alignment:
| Q |
191 |
gtttccatatgcaataatataaactactccatcactacaacactattaccctaacaatgccacagcagcatgcacatgaatccagtatgggcttccacat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10823640 |
gtttccatatgcaataatataaactactccatcactacaacactattacactaacaatgccacagcagcatgcacatgaatccagtatgggcttccacat |
10823739 |
T |
 |
| Q |
291 |
gaaaatggaccccatggttttcctttagccacttgtata |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10823740 |
gaaaatggaccccatggttttcctttagccacttgtata |
10823778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 17 - 146
Target Start/End: Original strand, 10823466 - 10823595
Alignment:
| Q |
17 |
aaaattggggtcctttgagtttgttttctgctcataagagaggaaaatgtctaaacgagtaacttcaaaatctacagcataattttcctcaacttcattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10823466 |
aaaattggggtcctttgagtttgttttctgctcataagagaggaaaatgtctaaacgagtaacttcaaaatctacagcataattttgctcaacttcattc |
10823565 |
T |
 |
| Q |
117 |
tccttagtccctaccttagttggaatctaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10823566 |
tccttagtccctaccttagttggaatctaa |
10823595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University