View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_12 (Length: 314)
Name: NF1717_low_12
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 26450834 - 26451136
Alignment:
| Q |
1 |
ctttgcatgtgtttggttctgcggtgccaaagttgattatactataatttgttttgattaaaagttagtttaacataaggtcatttatgtatggataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
26450834 |
ctttgcatgtgtttggttctgcggtgccaaagttgaatatactataattggttttgattaaaagttagtttaccataacg-catttatgtatggataatt |
26450932 |
T |
 |
| Q |
101 |
tatgagaaaactgttctttatcaattcattgcaatcggggaaccaaacacgggcatcgatgttttgttaattggaatcgtggtgtttatgaattgcttgt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26450933 |
tatgagaaaagtgttctttatcaattcattgcaatcgcggaaccaaacacggtcatcgatgttttgttaattggagtcgtggtgtttatgaattgcttgt |
26451032 |
T |
 |
| Q |
201 |
tttgtattgttattggatttgtttttcctgcttatacgcatccaaacatagaattggagctttttgatcattgtcttaagtggtggaatagcttgcttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26451033 |
tttgtattgttattggatttgtttttcctgcttatacgcatccaaacatagaattggagctttttgatcattgtcttaagtggtggaatagcttgcttgt |
26451132 |
T |
 |
| Q |
301 |
tcat |
304 |
Q |
| |
|
|||| |
|
|
| T |
26451133 |
tcat |
26451136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University