View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_15 (Length: 274)
Name: NF1717_low_15
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 135
Target Start/End: Original strand, 17514271 - 17514385
Alignment:
| Q |
20 |
tttttcatgctttactcaaaaacttcacatatctcccatatacatccatgggtagaaattgcccnnnnnnnnatatgaattgtgattagacagaatcttc |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |||||| ||||||| |
|
|
| T |
17514271 |
tttttcatgctttactcaaaatcttcacatatctcccatatacatccatgggtagaaattgccc-tctttttatttgaagtgtgactagacaaaatcttc |
17514369 |
T |
|
| Q |
120 |
atatatataatgagag |
135 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
17514370 |
atatatataattagag |
17514385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 261
Target Start/End: Original strand, 17514458 - 17514511
Alignment:
| Q |
208 |
gttgttttggcagaaaatttcagaatacctctaagggatcatataaccaccaac |
261 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
17514458 |
gttgttttggcacaaaatttcataatacctttgagggatcatataaccaccaac |
17514511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 257
Target Start/End: Original strand, 16856181 - 16856231
Alignment:
| Q |
208 |
gttgttttggcagaaaatttcagaatacctctaa-gggatcatataaccac |
257 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
16856181 |
gttgttttggcagaaaatttcataatacctttaaggggatcatataaccac |
16856231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University