View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_16 (Length: 269)
Name: NF1717_low_16
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 24 - 253
Target Start/End: Complemental strand, 43408057 - 43407834
Alignment:
| Q |
24 |
tgaagtgatctccctctcccattcccataggaatattattattgttggacatgtattgtgattgtggcgtagtttgctgcatggacatcaaactgttctc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
43408057 |
tgaagtgatctccctctcccattcccataggaatattattattgttggacatgtattgtgattgtggcgtagtttgctgcatggccatcaaactattctc |
43407958 |
T |
|
| Q |
124 |
acttgcttcaatccagcaaccttctcccaagagctcctcaattatatctgcttgatnnnnnnnnnnnnnnnnnnnnnncaccatcggtccaaacacacca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43407957 |
acttgcttcaatccagcaaccttctcccaacagctcctcaattatatctgcttgat------ctcctcctcctcctcccaccatcggtccaaacacacca |
43407864 |
T |
|
| Q |
224 |
ccgtcagccactaacccaccaccatattcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43407863 |
ccgtcagccactaacccaccaccatattcc |
43407834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University