View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_26 (Length: 238)
Name: NF1717_low_26
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 84 - 185
Target Start/End: Original strand, 10600410 - 10600511
Alignment:
| Q |
84 |
gtataaataaatagccaaatattggtaaaagatccttaaaataggttttagcgccatcataataacactaggcatttaacactcttcatattctatgcta |
183 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10600410 |
gtataaataaatagtcaaatattggtaaaagatccttaaaataggttttggcgccatcataataacactaggcatttaacactcttcatcttctatgcta |
10600509 |
T |
 |
| Q |
184 |
cg |
185 |
Q |
| |
|
|| |
|
|
| T |
10600510 |
cg |
10600511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 10599977 - 10600025
Alignment:
| Q |
17 |
taacaatttttatttgagcacatgttaatgattctacaacaaaaaataaat |
67 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10599977 |
taacaatttttatttgagcac--gttaatgattctagaacaaaaaataaat |
10600025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Complemental strand, 2567821 - 2567789
Alignment:
| Q |
57 |
aaaaaataaattaacacaatttacgatgtataa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
2567821 |
aaaaaataaattaacacaatttacgatgcataa |
2567789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University