View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_28 (Length: 237)
Name: NF1717_low_28
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 221
Target Start/End: Complemental strand, 7259500 - 7259298
Alignment:
| Q |
21 |
tttgttttcttttataatttgttttgaaccatctca--atagggggtccaaactatacttatcttttaaggtgtctatgttttattttcagttatgtttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7259500 |
tttgttttcttttataatttgttttgaaccatcccactataggtggtccaaactatacttatcttttaaggtgtctatgttttattttcagttatgtttc |
7259401 |
T |
 |
| Q |
119 |
aacatatgcacatctttttgaagttatacggtgatgctaatgaagatcttttgatctttggcatgcaatcaatgttcttttttaaggatacatgcaaagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7259400 |
aacatatgcacatctttttgaagttatacggtgatgctaatgaagatcttttgatctttggcatgcaaacaatgttcttttttaaggatacatgcaaagg |
7259301 |
T |
 |
| Q |
219 |
aat |
221 |
Q |
| |
|
||| |
|
|
| T |
7259300 |
aat |
7259298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University