View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_29 (Length: 236)
Name: NF1717_low_29
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 26194960 - 26195062
Alignment:
| Q |
1 |
cttttgggaattgcattccactacccttttgagcacttatcaaaagaacctctatttccttttcttgggttccattcnnnnnnnatctataaggtatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26194960 |
cttttgggaattgcattccactacccttttgagcacttatcaaaagaacctctatttccttttcttgggttccattctttttgtatctataaggtatgca |
26195059 |
T |
 |
| Q |
101 |
tct |
103 |
Q |
| |
|
||| |
|
|
| T |
26195060 |
tct |
26195062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University