View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717_low_32 (Length: 227)
Name: NF1717_low_32
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717_low_32 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 52712703 - 52712483
Alignment:
| Q |
7 |
aaagggaacgatagcttggggaagagcagcctgcaaaagtaattaaacatgattatgttgataaactactaattagaataaagtcattaattgaatttga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712703 |
aaagggaacgatagcttggggaagagcagcctgcaaaagtaattaaacatgattgtgttgataaactactaattagaataaagtcattaattgaatttga |
52712604 |
T |
|
| Q |
107 |
tttgacctgaacaattgcaacatgtcagagaactccacggagaccaactgctaacgaggttgccgcaataacagctggaccgaccaagaaccttacagcc |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52712603 |
tttgacctgaacaattgcaacatgtaagagaactccacggagaccaactgctaacgaggttgccgcaatcacagctggaccgaccaagaaccttacagcc |
52712504 |
T |
|
| Q |
207 |
atagaatatgttgcaattttt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52712503 |
atagaatatgttgcaattttt |
52712483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 111 - 222
Target Start/End: Complemental strand, 52718253 - 52718142
Alignment:
| Q |
111 |
acctgaacaattgcaacatgtcagagaactccacggagaccaactgctaacgaggttgccgcaataacagctggaccgaccaagaaccttacagccatag |
210 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| ||||| ||||| |||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
52718253 |
acctgaacaattgcaacatgtaacagaactccacggataccaattgctattgaggttgccgcaatcacagctggaccggtcaagaaccttacagccatag |
52718154 |
T |
|
| Q |
211 |
aatatgttgcaa |
222 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
52718153 |
aaaatgttgcaa |
52718142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University