View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718-Insertion-1 (Length: 113)
Name: NF1718-Insertion-1
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 38945796 - 38945901
Alignment:
| Q |
8 |
gatggttcaaatttgttttatatagagataagaacatctagacaatcctgcacacaaccacacatgttttccctacgagtccatccccacattcacagta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38945796 |
gatggttcaaatttgttttatatagagataagaacatctagacaatcctgcacacaaccacacatgtttgccctacgagtccatccccacattcacagta |
38945895 |
T |
|
| Q |
108 |
tattta |
113 |
Q |
| |
|
|||||| |
|
|
| T |
38945896 |
tattta |
38945901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University