View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17180_low_12 (Length: 251)
Name: NF17180_low_12
Description: NF17180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17180_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 36206721 - 36206476
Alignment:
| Q |
1 |
cctttggatagcctcccccaaactgttttatcatctcatacacaaatttaatccatgtttgtatgtttaaggaa-ttggaatgaccnnnnnnnnncggtt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
36206721 |
cctttggatagcctcccccaaactgttttatcacctcatacacaaatttaatccatgtttgtatgtttaaggaatttggaatgacc-tttttttccggtt |
36206623 |
T |
 |
| Q |
100 |
tatcggaattagttctattcaagatatcacc-ggatacgaaatgtgaagacattttnnnnnnnnttgaaatcttatttcgttagtgtgggagacttactt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36206622 |
tatcggaattagttctattcaagatatcaccgggatacgaaatgtgaagacattttaaaaaaaattgaaatcttatttggttagtgtgggagacttactt |
36206523 |
T |
 |
| Q |
199 |
tttctattaaagtaaacttccatttgtaaaactgccatattcttgga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36206522 |
tttctattaaagtaaacttccatttgtaaaactgccattttattgga |
36206476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University