View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17180_low_14 (Length: 239)
Name: NF17180_low_14
Description: NF17180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17180_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 49917673 - 49917853
Alignment:
| Q |
1 |
caaaattgtaaaatcaacaattcttcatgcaaagttgataacgtttgagatcaacaaagcaaacaaaaattggttaattaaacaattcagaaatatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49917673 |
caaaattgtaaaatcaacaattcttcatgcaaagttgataacgtttgagatcaacaaagcaaacaaaaattggttaattaaacaattcagaaatatgaga |
49917772 |
T |
 |
| Q |
101 |
gatttttcattggctttgcattggaaaagatttgaatgttacagcgccacgatttggtgtgcatgcattgttattattatt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49917773 |
gatttttcattggctttgcattggaaaagatttgaatgttacagcgccacgatttggtgtgcatgcattgttattattatt |
49917853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Original strand, 23628344 - 23628376
Alignment:
| Q |
171 |
ttattattattattatgacaaatgatatttgaa |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
23628344 |
ttattattattattatgagaaatgatatttgaa |
23628376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University