View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17180_low_7 (Length: 320)
Name: NF17180_low_7
Description: NF17180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17180_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 309
Target Start/End: Original strand, 12031145 - 12031429
Alignment:
| Q |
17 |
aatggcatgccttgagcacaaggctagcatgcaacaatgaagtgcttatcttggaaatgcagagggcttgagatttgagaacccttttgcagtgagagct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12031145 |
aatggcatgccttgagcacaaggctagcatgcaacaatgaagtgcttgtcttggaaatgcagagggcttgaga-------acccttttgcagtgagagct |
12031237 |
T |
|
| Q |
117 |
ctgaaaaagctcctcaaaactcattgtcctgatgtggtttttcttatggaaacaaggcttaaagaaactgataccaaagctaagtctagtttagtttgtg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12031238 |
ctgaaaaagctcctcaaaactcattgtcctggtgtggtttt-cttatggaaacaaggcttaaagaaactgataccaaagctaagtctagtttagtttgtg |
12031336 |
T |
|
| Q |
217 |
gcccgctttctaatttgttcatgattgactttaattcttttaatgaccatagatctggcccttctttggaatgatgtttttaatgttgatatt |
309 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12031337 |
gtccgctttctaatttgttcatgattgactttaattcttttaatggccataggtctggcccttctttggaatgatgtttttaatgttgatatt |
12031429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 95 - 177
Target Start/End: Complemental strand, 23862493 - 23862411
Alignment:
| Q |
95 |
gaacccttttgcagtgagagctctgaaaaagctcctcaaaactcattgtcctgatgtggtttttcttatggaaacaaggctta |
177 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||| ||||| |||||| ||| | |||||| |||||||||| ||||||| |
|
|
| T |
23862493 |
gaaccctactgcagttagagctctaaaaaagctccttaaaacaacttgtccagatttagttttttttatggaaactaggctta |
23862411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University