View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17180_low_8 (Length: 313)
Name: NF17180_low_8
Description: NF17180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17180_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 171 - 311
Target Start/End: Complemental strand, 34962067 - 34961927
Alignment:
| Q |
171 |
aatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaatcttctcgacgtcgattcttgtgatttgtctatatgtaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||| || ||||||||| |
|
|
| T |
34962067 |
aatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaatcttctcaacatcaattcttgtgattagtttatatgtaa |
34961968 |
T |
 |
| Q |
271 |
tcttgttctgactataaatggatctctcattggaaatagta |
311 |
Q |
| |
|
||||||||||||| ||||| || || || |||||||||||| |
|
|
| T |
34961967 |
tcttgttctgactttaaatagaactttcgttggaaatagta |
34961927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 132 - 231
Target Start/End: Complemental strand, 34962166 - 34962067
Alignment:
| Q |
132 |
gactatttatgaatagatttcaagattaaaatgactaataatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaa |
231 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962166 |
gactatttataaatagatttcaagattaaaatgactaataatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaa |
34962067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 34962297 - 34962252
Alignment:
| Q |
1 |
tctcgttaaccgtctcttctttggagcaaatatttcctcactagtt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34962297 |
tctcgttaaccgtctcttctttggagcaaatatttccttactagtt |
34962252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University