View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_high_16 (Length: 317)
Name: NF17185_high_16
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 61 - 310
Target Start/End: Complemental strand, 3759074 - 3758825
Alignment:
| Q |
61 |
gttacggctatggtactcattcaaaaactttctagtagcttcctccaccttagccctaccctcttccaccccacaaaaacgtaccgttttgtaatcattt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
3759074 |
gttacggctatggtactcattcaaaaactttctagtagcttcctccaccttagctctaccctcttccactccacaaaaaccaacagttttgtaatcattt |
3758975 |
T |
 |
| Q |
161 |
ctaccacaaaatgacgcggttttgctcaaacaagaccgtgaaaatgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgt |
260 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3758974 |
ctaccacaaaatgacgctgttttgctcaaacaagaccgcgaaaacgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgt |
3758875 |
T |
 |
| Q |
261 |
tcatttgcttcttcgtctttgttggtttctcagtcttcgttttcatctca |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3758874 |
tcatctgcttcttcgtctttgttggtttctcagtcttcattttcttctca |
3758825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University