View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_high_26 (Length: 266)
Name: NF17185_high_26
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_high_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 47441529 - 47441275
Alignment:
| Q |
19 |
ttattcacttattctgggaaggaaatttgtaatgagtgtttggttttccccaaatcatatgctgaccttgaacttacaagctgtgtcgtcaattttgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441529 |
ttattcacttattctgggaaggaaatttgtaatgagtgtttggttttctccaaatcatatgctgaccttgaacttacaagctgtgtcgtcaattttgaag |
47441430 |
T |
 |
| Q |
119 |
atttaaaggaatagcatggtggtgtttagtagttgaacgtccgttctgt-------ggcatgttttttcttgtttataaattataatagtccattttgag |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441429 |
atttaaaggaatggcatggtggtgtttagtagttgaatgtccgttctgtggcaagtggcatgttttttcttgtttataaattataatagtccattttgag |
47441330 |
T |
 |
| Q |
212 |
catgcactggggtgctcaaaatatggaaatggtatttgcagcattcagacggacc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47441329 |
catgcactggggtgctcaaaatatggaaatggtatttgcagcgttcagacggacc |
47441275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University