View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_high_27 (Length: 260)
Name: NF17185_high_27
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_high_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 260
Target Start/End: Original strand, 32340601 - 32340852
Alignment:
| Q |
9 |
aacagagatgcctttgtcccaaaatctgttgaagccaacatatcaccaaacacacctaactcaggacactcactccattgatcatgtccatgtaacaaaa |
108 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340601 |
aacacagatgcctttgtcacaaaatctgttgaagccaacatatcaccaaccacacctaactcaggacactcactccattgatcatgtccatgtaacaaaa |
32340700 |
T |
|
| Q |
109 |
cagattgaggatgtcccctcccaaccataactaaatcaaaataatctatcattcttcttatactagaagaaaattccattccatctttcacaacttcttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32340701 |
cagattgaggatgtcccctcccaaccataactaaatcaaaataatctatcattcttcttatactagaagaaaattctattccatctttcacaacttcttc |
32340800 |
T |
|
| Q |
209 |
agttatctcaaaccttatatttccagcattgtaatatctatattcatctact |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340801 |
agttatctcaaaccttatatttccagcattgtaatatctatattcatctact |
32340852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University