View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_high_32 (Length: 247)
Name: NF17185_high_32
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 32340834 - 32341062
Alignment:
| Q |
1 |
atatctatattcatctactagatcactgtcatgttttctatcttttgaattttcttctccgaatgtgaggaatctaaccacggttacattcacacattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340834 |
atatctatattcatctactagatcactgtcatgttttctatcttttgaattttcttctccgaatgtgaggaatctaaccacggttacattcacacattca |
32340933 |
T |
|
| Q |
101 |
tgtctagccattctacttgcataggctagtgcctcggcatcatctgcacctccaatgaagagaactgcaatatagtatgttgccttggatattaaaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340934 |
tgtctagccattctacttgcataggctagtgcctcggcatcatctgcacctccaatgaagagaactgcaatatagtatgttgccttggatattaaaagtg |
32341033 |
T |
|
| Q |
201 |
atggagaaccacttaagatgcctcggtcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32341034 |
atggagaaccacttaagatgcctcggtcg |
32341062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 161
Target Start/End: Original strand, 36062442 - 36062529
Alignment:
| Q |
74 |
ctaaccacggttacattcacacattcatgtctagccattctacttgc-ataggctagtgcctcggcatcatctgcacctccaatgaaga |
161 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||| |||||| | || |||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
36062442 |
ctaaccaccgttacattcaaatattcatgtctacacattct-cgagctataggctagtgcttcgatatcatctgcacctccaatgaaga |
36062529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University