View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_high_34 (Length: 239)
Name: NF17185_high_34
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 46007580 - 46007801
Alignment:
| Q |
1 |
cttgttttcaaacttcttcatattcactagtttaccaattatgggcaaggattggtattggactggaagaagaagatcctccaagagaacagaagctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46007580 |
cttgttttcaaacttcttcatattcactagtttaccaattatgggcaaggattggtattggactggaagaagaagatcctccaagaaaacagaagctgct |
46007679 |
T |
|
| Q |
101 |
gaaacagatatcccttctggttgcatgtgtgctgtttttcaagcctttgattttcatccctttcaactttccattaaccaacaacaatcctctttcaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46007680 |
gaaacagatatcccttctggttgcatgtgtgctgtttttcaagcctttgattttcatccctttcaacttcccattaaccaacaacaatcctctttcaact |
46007779 |
T |
|
| Q |
201 |
cttcttctcccatacactctct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46007780 |
cttcttctcccatacactctct |
46007801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 22719530 - 22719483
Alignment:
| Q |
118 |
tggttgcatgtgtgctgtttttcaagcctttgattttcatccctttca |
165 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
22719530 |
tggttgcatgtgtgctttttttcaattctttgattttcatccttttca |
22719483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University