View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17185_low_30 (Length: 255)
Name: NF17185_low_30
Description: NF17185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17185_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 25919355 - 25919579
Alignment:
| Q |
11 |
cagagatctagtaaattttcccaagtacattttcaactacttatgtgacaacatcaaggaacgaaagacatttatttcgtaaggaagacttctgtcatac |
110 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25919355 |
cagagatatagtaaatttgcccaagtacattttcaactacttatgtgacaacatcaaggaacaaaagacatttatttcgtaaggaagacttctgtcatac |
25919454 |
T |
|
| Q |
111 |
attttctatcaaagcaagatcattgaactgttagaaaaccttcaagctatggaagatcctgaaatcatttttgggaaaacttttgatgcccagactttgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25919455 |
attttctatcaaagcaagatcattgaactgttagaaaaccttcaagctattgaagatcctgaaatcatttttgggaaaacttttgatgcccagactttgg |
25919554 |
T |
|
| Q |
211 |
tacaaatgaaactcatgaagacagc |
235 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
25919555 |
tacaaatgaaactcataaagacagc |
25919579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University