View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17186_low_6 (Length: 294)
Name: NF17186_low_6
Description: NF17186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17186_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 24 - 285
Target Start/End: Original strand, 25894946 - 25895207
Alignment:
| Q |
24 |
actgcatcactgatatttatctgcttcttgtcactaggcttaactggggaaggggatgacggtggttttaaatcctcataactgaaaatttatataccaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25894946 |
actgcatcactgatatttatctgcttcttgtcactaggcttaactggggaaggggatgacggtggttttaaatcctcataactgaaaatttatataccaa |
25895045 |
T |
 |
| Q |
124 |
attagttatttggcctccgtagtccacataaaaatttactgtcaacaaatattagcaagctggcttacgcagtataaggagaaagcggctgttttgccac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25895046 |
attagttatttggcctccgtagtccacataaaaatttactgtcaacaaatattagcaagctggcttacgcagtataaggagaaagcggctgttttgccac |
25895145 |
T |
 |
| Q |
224 |
tggtttcggttgttctgtttctttctgaggagtaatgctaggtacttctgccacaggttctg |
285 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
25895146 |
tagtttcggttgttctgtttctttctgaggagtgatgctaggtacttctgccactggttctg |
25895207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 25895194 - 25895245
Alignment:
| Q |
218 |
tgccactggtttcggttgttctgtttctttctgaggagtaatgctaggtact |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25895194 |
tgccactggttctggttgttctgtttctttctgaggggcaatgctaggtact |
25895245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University