View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17186_low_8 (Length: 270)
Name: NF17186_low_8
Description: NF17186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17186_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 22224531 - 22224799
Alignment:
| Q |
1 |
gtaatttatgttagatagtaacttaagacacatcaaccattggttagatttaacattggagatcacatgtgcatgtaatactaataattgatttttaata |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22224531 |
gtaatttatgttagatagtaacgtaagacacatcaaccattggttagatttaacattggagatcacatgtgcatgtaatactaataattgatttttaata |
22224630 |
T |
 |
| Q |
101 |
atagttaattctttactgttaaaattgactttattttagaatagtcaaattcaattttctaatcttaagcacacagggttaagcttggtttgtcactacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
22224631 |
atagttaattctttactgttaaaattgactttattttagaatagtcaaattcaattttttaatcttaag--cacagggttaagcttggtttgttactacc |
22224728 |
T |
 |
| Q |
201 |
aa-----------------ttgcgctgtgctggtac-gcaaaagagtagtagagggagatatgccataaat |
253 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22224729 |
aactctttgttgtgaagagttgcgctgtgctggtactccaaaagagtagtagagggagatatgccataaat |
22224799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University