View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17186_low_9 (Length: 266)
Name: NF17186_low_9
Description: NF17186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17186_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 7034989 - 7035100
Alignment:
| Q |
1 |
gatagcaacataactgtaatattgactggactaagtcggtactcattagtcaagtcatcaacagggcttaatctgatatctagcttgttgaatgcagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7034989 |
gatagcaacataactgtaatattgactggactaagtcggtactcattagtcaagtcatcaacagggcttaatctgatatctagcttgttgaatgcagcta |
7035088 |
T |
 |
| Q |
101 |
taatttaaagtc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7035089 |
taatttaaagtc |
7035100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 170 - 247
Target Start/End: Original strand, 7035151 - 7035228
Alignment:
| Q |
170 |
atgcagatatccagtagtagcataagtttatttgtttatctcactctctttatgctgatattttctcctactagttcc |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7035151 |
atgcagatatcctgtagtagcataagtttatttgtttatctcactctctttatgctgatattttctcctactagttcc |
7035228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 219
Target Start/End: Original strand, 7028415 - 7028456
Alignment:
| Q |
178 |
atccagtagtagcataagtttatttgtttatctcactctctt |
219 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
7028415 |
atccagtagtagcataagtttgtttctttatctcactctctt |
7028456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University