View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17187_high_11 (Length: 250)
Name: NF17187_high_11
Description: NF17187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17187_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 234
Target Start/End: Original strand, 12642628 - 12642868
Alignment:
| Q |
4 |
accttcatattacggtgaaacctgagaaaatgccgctgaggtggtcgaatttgcaattgcgatgttgtcatagaaacttcaaaatctctgatattactgc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12642628 |
accttcatattactgtgaaacctgagaaaatgccgctgaggtgatcgaatttgcaattgcgatgttgtcatagaaacttcaaaatctctgatattactgc |
12642727 |
T |
 |
| Q |
104 |
tgcaactgcggttgcagcccacaacttaaaatcatatagtctgatctacaacttcagaacaaccatataacttgtg----------ttctttgatagcaa |
193 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
12642728 |
tgcaactgcggtcgcagcccacaacttaaaatcatatagtctgatctacagcttcagaacaatcatataacttgtgttctttatccttctttgatagcaa |
12642827 |
T |
 |
| Q |
194 |
tttgacctgtttgatactagcgatcatggtagtggcaacat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12642828 |
tttgacctgtttgatactagcgatcatggtagtggcaacat |
12642868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University