View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17187_low_11 (Length: 259)
Name: NF17187_low_11
Description: NF17187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17187_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 42 - 249
Target Start/End: Complemental strand, 41522266 - 41522059
Alignment:
| Q |
42 |
tggggcttttgggagggaagaagaagaaaataaagacatatttcacttaatttgtacaaagaatgataaattaaatacatgtttataactaatatattgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41522266 |
tggggcttttgggagggaagaagaagaaaataaagacatatttcacttaatttgtacaaagaatgataaattaaatacatgtttataaccaatatattgt |
41522167 |
T |
 |
| Q |
142 |
taatttgaggttattctttcannnnnnnngaggttattgtaacaatataaattcattttgaagaatttatttgtgtctttcaaaatctttaaaatccctc |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41522166 |
taatttgaggttattctttcaatttttttgaggttattgtaacaatataaattcattttgaagaatttatttgtgtctttcaaaatctttaaaatccctc |
41522067 |
T |
 |
| Q |
242 |
ctcctatg |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
41522066 |
ctcctatg |
41522059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University