View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17187_low_12 (Length: 253)
Name: NF17187_low_12
Description: NF17187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17187_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 116 - 231
Target Start/End: Original strand, 47231765 - 47231880
Alignment:
| Q |
116 |
taccggagaagaactcgccggcggtgggattagattgaagatgatcggaagagttatcttcgacggcggtgatgaggtgggcattgatagctttgagacg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47231765 |
taccggagaagaactcgccggcggtgggattagattgaagatgatcggaagagttatcttcgacggcggtgatgaggtgggcattgatagctttgagacg |
47231864 |
T |
 |
| Q |
216 |
acgttgcgctgtaggt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47231865 |
acgttgcgctgtaggt |
47231880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 47231654 - 47231735
Alignment:
| Q |
9 |
gaaatgaataagaaaacgcatatccacacagaaagaggagtatcacaatttcatgatgatccacctaattaatttcagaagt |
90 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47231654 |
gaaaagaataagaaaacgcatatccacacagaaagaggagtatcacaatttcatgatgatccacctaattaatttcagaagt |
47231735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University