View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17188_high_33 (Length: 280)
Name: NF17188_high_33
Description: NF17188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17188_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 266
Target Start/End: Complemental strand, 52302299 - 52302046
Alignment:
| Q |
13 |
gaacaacctcactaacaccgtcaaaaaatacgccgacaccgtcgttcaacacgccggtcaagccgttgctgaaggcgccaaaatccttcatgatcgcatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302299 |
gaacaacctcactaacaccgtcaaaaaatacgccgacaccgtcgttcaacacgccggtcaagccgttgctgaaggcgccaaaatccttcatgatcgcatt |
52302200 |
T |
 |
| Q |
113 |
gtaaattccgcattcctaatattttattgcaattttaggcctaattattatcctaatttaagcaacattagtttaattcaattctggtttatgcagttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302199 |
gtaaattccgcattcctaatattttattgcaattttaggcctaattattatcctaatttaagcaacattagtttaattcaattctggtttatgcagttct |
52302100 |
T |
 |
| Q |
213 |
aattaacttgctaagttactatttagtgttttgaattttgaaacgagagtatag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52302099 |
aattaacttgctaagttactatttagtgttttgaattttgaaacgagagtatag |
52302046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University