View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17188_high_40 (Length: 247)

Name: NF17188_high_40
Description: NF17188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17188_high_40
NF17188_high_40
[»] chr4 (2 HSPs)
chr4 (107-235)||(52395903-52396031)
chr4 (1-30)||(52396050-52396079)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 107 - 235
Target Start/End: Complemental strand, 52396031 - 52395903
Alignment:
107 aaaattaattttgttaaaaagttgatttaacataaaatgattcatatttatagggagctatgaatgtttggttcctcttttacagatgttgaattgattt 206  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
52396031 aaaattaattttgttaaaaagttgatttaacataaaatgatccatatttatagggagctatgaatgtctggttcctcttttacagatgttgaattgattt 52395932  T
207 ttgacatgtttgttgttctcgattagaat 235  Q
    |||||||||||||||||||||||||||||    
52395931 ttgacatgtttgttgttctcgattagaat 52395903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 52396079 - 52396050
Alignment:
1 gttatcattgcatacatatttataatcttg 30  Q
    ||||||||||||||||||||||||||||||    
52396079 gttatcattgcatacatatttataatcttg 52396050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University