View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17188_high_47 (Length: 213)
Name: NF17188_high_47
Description: NF17188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17188_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 7500787 - 7500590
Alignment:
| Q |
1 |
tcatccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgccacttgatctgcaacaacgagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7500787 |
tcatccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttccgaccttcgccacttgatctgcaacaacgagga |
7500688 |
T |
 |
| Q |
101 |
attatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500687 |
attatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttct |
7500590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 198
Target Start/End: Complemental strand, 7502118 - 7502023
Alignment:
| Q |
103 |
tatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttct |
198 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| |||| || |||||| ||||| | | | ||| |||||||||| ||||||||| |||| |||| |
|
|
| T |
7502118 |
tatggcggaatatttgcacctcaaagtggccttcccttatggatccaatcgttaacgatgtcatctccactttccccggtggttacagttcattct |
7502023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 121
Target Start/End: Original strand, 27253110 - 27253177
Alignment:
| Q |
54 |
tcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcac |
121 |
Q |
| |
|
|||||||||| ||| || || |||||| |||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
27253110 |
tcctgtgtatcttcagaactccgccacatgatctgcaacaacgaagatctatggcggaacatatgcac |
27253177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University